Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 

 Table of Contents  
ORIGINAL ARTICLE
Year : 2020  |  Volume : 18  |  Issue : 4  |  Page : 296-299

Serological and molecular methods in diagnosis of lower respiratory tract infections caused due to Chlamydia pneumoniae


1 Department of Clinical Microbiology, Christian Medical College, Vellore, Tamil Nadu, India
2 Department of Child Health, Christian Medical College, Vellore, Tamil Nadu, India

Date of Submission14-Mar-2020
Date of Decision02-May-2020
Date of Acceptance13-May-2020
Date of Web Publication19-Oct-2020

Correspondence Address:
Dr. Susmitha Karunasree Perumalla
Department of Clinical Microbiology, Christian Medical College, Vellore - 632 004, Tamil Nadu
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/cmi.cmi_33_20

Rights and Permissions
  Abstract 


Introduction: Lower respiratory tract infections (LRTIs) continue to be a major health problem in children. Increasingly “atypical” agents such as Chlamydophila pneumoniae are being recognized as a significant cause of LRTI. The current study evaluated serological and molecular methods in detection of LRTI due to C. pneumoniae in young children. Materials and Methods: Serum and nasopharyngeal aspirate (NPA) were collected from 53 treatment-naïve children (6 months–6 years) with LRTI. Immunoglobulin M (IgM) and IgG antibodies to C. pneumoniae were detected in serum by enzyme-linked immunosorbent assay (ELISA) and microimmunofluorescence (MIF) test. Nonnested polymerase chain reaction (PCR) to detect a 183-bp fragment of the 60-kDa outer membrane protein 2 of C. pneumoniae was performed on DNA extracted from the NPA samples. Results: Of the 53 children tested, 14 (26.4%) children were diagnosed to have acute C. pneumoniae infection according to CDC guidelines. When compared with IgM MIF (reference test), PCR and IgM ELISA showed a sensitivity of 36% and 71%, respectively, and a specificity of 100%. IgG antibodies were positive in an additional 8 cases, by both MIF and ELISA, suggesting “possible” reinfection. Conclusion: This study despite its drawbacks provides evidence that C. pneumoniae is a significant cause of LRTI in young children.

Keywords: Chlamydia pneumoniae, lower respiratory tract infections, microimmunofluorescence, polymerase chain reaction and enzyme-linked immunosorbent assay


How to cite this article:
Ashwin Y B, Perumalla SK, Verghese VP, Simon A, Agarwal I, Prakash JA. Serological and molecular methods in diagnosis of lower respiratory tract infections caused due to Chlamydia pneumoniae. Curr Med Issues 2020;18:296-9

How to cite this URL:
Ashwin Y B, Perumalla SK, Verghese VP, Simon A, Agarwal I, Prakash JA. Serological and molecular methods in diagnosis of lower respiratory tract infections caused due to Chlamydia pneumoniae. Curr Med Issues [serial online] 2020 [cited 2020 Nov 26];18:296-9. Available from: https://www.cmijournal.org/text.asp?2020/18/4/296/298590




  Introduction Top


Lower respiratory tract infection (LRTI) is a major cause of morbidity and mortality in children with nearly one million deaths occurring yearly worldwide.[1] Diagnosis of LRTI is generally made based on both clinical and laboratory findings. The main causes of LRTI in young children are viruses and bacteria. Although respiratory pathogens can be identified in about 25%–50% of cases of LRTI,[2],[3],[4],[5],[6] initial therapy is generally empiric. This is so because of the inability to determine the causative organisms in most of the patients by the time treatment is initiated.[7] One of the factors contributing to the unidentified etiology in LRTI is the difficulty in identifying atypical pathogens such as Mycoplasma pneumoniae, C. pneumoniae, Legionella spp. that do not respond to routinely used beta-lactam antibiotics for LRTI. The present study was done to determine the incidence of LRTI due to Chlamydia pneumoniae in young children.


  Materials and Methods Top


This study was conducted between March 2008 and August 2009 after obtaining approval from the institutional review board and ethics committee (No: 22 × 279). Totally, 53 treatment-naïve children with clinical features suggestive of LRTI between the ages of 6 months to 6 years attending the child health outpatient clinic were recruited. Nasopharyngeal aspirate (NPA) and serum samples were collected after written consent was obtained from the parent/guardian.

Detection of immunoglobulin M (IgM) and IgG antibodies against C. pneumoniae by enzyme-linked immunosorbent assay (ELISA) and microimmunofluorescence (MIF) using the serum samples was performed using commercially available kits (Euroimmun AG, Lubeck, Germany) as per the manufacturer's instructions. MIF was positive for C. pneumoniae if antibodies showed a fluorescence of the inclusion bodies at a dilution of 1:16 for IgM. This was considered as the reference test as per standard guidelines.[8] A sample was considered as IgG MIF positive if the sample was positive at a titer of 1:512.

Polymerase chain reaction amplification

The sequence encoding the 60-kDa cysteine-rich outer-membrane protein 2 (Omp2) of C. pneumoniae was amplified using the nonnested polymerase chain reaction (PCR) protocol described by Petitjean et al.[9] on the NPA samples. The primer sequences used were CP1 (forward primer): 5' CAGAAGAAAAAAATAAACATGCGATAGG and CP2 (reverse primer): 5' AACAGGTGCTGGCTTTGTTTCCG CACTA 3' (synthesized by M/s Sigma-Aldrich Chemicals Pvt. Ltd, Bangalore, India). Amplification was performed using the “VERITI” 96-Well Thermal Cycler (Applied Biosystems, Foster City, CA, USA). Genomic DNA from C. pneumoniae-infected cells (EU 38) was used as a positive control. Target amplification included an initial denaturation of 94°C for 5 min, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 61°C for 30 s, and extension of 72°C for 30 s, followed by a final extension of 72°C for 4 min. The PCR product was detected by electrophoresis in a 1.2% agarose gel with ethidium bromide to which 10 μl of the amplified product was added and visualized using a gel documentation system.

Statistical analysis

Percentages were used for descriptive statistics. Sensitivity and specificity were calculated using a 2 × 2 table comparing the performance of tests with MIF, the reference test.


  Results Top


Among the 53 children recruited, 36 (67.92%) were male and 17 (32.07%) were female. Twelve of them (22.6%) were <2 years and 38 (71.7%) were between 2 and 5 years of age. The immunization was complete for age at the time of recruitment. IgM MIF was positive in 14 (26.4%), whereas the C. pneumoniae IgM ELISA was positive in 10 (18.86%) of these cases. IgG MIF and ELISA positives were seen in additional eight and seven cases, respectively. Nonnested PCR done to detect the 183-bp target sequence encoding the 60-kDa cysteine-rich Omp2 of C. pneumoniae was positive in 5 (9.43%) children with acute infection. ELISA done to detect IgG antibody response to major outer-membrane protein (MOMP) of C. pneumoniae was positive in 7 children considered to have “possible reinfection.” The performance of IgM ELISA and PCR is represented in [Table 1]. IgM ELISA showed a sensitivity and specificity of 71% and 100%, respectively, when compared to MIF, and PCR showed a sensitivity and specificity of 36% and 100%, respectively.
Table 1: Performance of polymerase chain reaction and immunoglobulin M enzyme-linked immunosorbent assay in detection of acute lower respiratory tract infections due to Chlamydia pneumoniae (n=53)

Click here to view



  Discussion Top


LRTIs remain a significant cause of mortality and morbidity in our country, especially in children. The prevalence of C. pneumoniae infections in our study was 26.4% among our group of patients. Other studies from India have reported a prevalence of up to 10% for LRTI due to C. pneumoniae in children <5 years who required hospitalization.[10],[11] As the illness is mild and classified as a “walking” pneumonia, most of the affected individuals are managed on an outpatient basis. The higher incidence in our study is most likely due to the inclusion of treatment-naïve patients, majority (45, 84.9%) of whom were not hospitalized.

The low sensitivity of the PCR is definitely related to our usage of NPA instead of bronchoalveolar lavage (BAL), the preferred sample. BAL was not collected as the procedure is invasive, expensive, laborious requiring a high degree of skill and associated with an increased risk of complications. The alternate samples that can be used are swabs from the nasopharynx or throat, NPA, and gastric lavage.[12] A well coughed out sputum sample, though superior to NPA, was not feasible considering the age of our study population (<6 years) and the fact that most of the patients infected with these agents present with a nonproductive cough. NPA specimens were tested in our study because it has been shown to be the most “ideal” noninvasive sample, although the yield of DNA could be lower.[13] PCR inhibitors probably did not play a major role in the lower yield of PCR as the DNA extraction kit (QIAamp Blood Mini Kit, Qiagen, Hilden, Germany) used in our study ensured DNA of good quality. This is corroborated by Daugharty et al., who reviewed seven different DNA extraction kits/procedures and recommend the usage of the QIAamp Blood Mini Kit because of the sensitivity, simplicity, and rapidity of the procedure.[14] Another factor that may have contributed to the lower sensitivity is the use of a nonnested PCR assay in our study. This protocol has a far higher limit of detection than a nested or a real-time PCR assay.[15] We used a nonnested protocol as it is less labor intensive and has less contamination rates compared to nested protocols.[8] Further molecular tests using well-defined nested protocols or real-time PCR assays need to be done to assess the usefulness of molecular assays in diagnosing C. pneumoniae infection.

As observed by Wang, sterilizing immunity might have developed by the time patient sought medical aid. In such an event, serology is bound to be positive, whereas molecular assays such as PCR will be negative.[16]

MIF has excellent sensitivity and specificity comparable to antigen detection methods. This high sensitivity and specificity is due to the use of elementary bodies of C. pneumoniae where there is a maximum expression of the genus-specific epitopes as compared to that in reticulate bodies.[16] The intralaboratory and interlaboratory variability in interpretation referred to by many authors[8] is most likely due to a lack of experience, and hence, expertise required to interpret the same. The occurrence of false positives by MIF was ruled out by adsorption of IgG antibodies.[17]

In contrast to the MIF where the whole organism (elementary body) is used as the antigen, the ELISA detected antibodies against the MOMP which is not the immunodominant antigen of C. pneumoniae as compared to other species of Chlamydia.[18] The lower sensitivity of the ELISA in comparison to the MIF can be attributed to this factor which may be further compounded by the possible loss of epitopes during manufacture of the assay. Although the low sensitivity of the ELISA was known, it was evaluated as it has distinct advantages over the reference assay. These include batch testing, requirement of less expertise (as the technique is simple), and availability of objective endpoints. “Possible reinfections” are known to occur with C. pneumoniae, but presently, there is no consensus on the criteria to determine these. A possible reinfection is suggested when an IgG titer of ≥512 is seen by MIF.[19] An ELISA to detect these antibodies was performed to evaluate the utility of this assay for the same. Eight (15%) of our patients were considered to be possible reinfections using the aforementioned criteria. This finding correlates with other studies which have reported that both IgM MIF and PCR could be negative in case of “possible reinfection,” but IgG antibodies can be detected in serum.[16] Population-based studies need to be undertaken to determine the titer to diagnose reinfections unequivocally.


  Conclusion Top


We have found that a significant number of LRTI in young children is caused by C. pneumoniae. Detection of IgM antibodies by MIF, the reference test, had the highest likelihood of proving the etiological role. Criteria for reinfection for individual agents need to be defined by large-scale community-based seroepidemiological studies. Prospective studies with newer and more sensitive molecular assays are imperative to assess their utility as diagnostic tests.

Acknowledgment

We would like to thank the Fluid Research Grant, Christian Medical College, Vellore.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

Research quality and ethics statement

The authors of this manuscript declare that this scientific work complies with reporting quality, formatting, and reproducibility guidelines set forth by the EQUATOR Network. The authors also attest that this clinical investigation was determined to require the institutional review board/ethics committee review, and the corresponding protocol/approval number is IRB Min no: 22 × 279. We also certify that we have not plagiarized the contents in this submission and have done a plagiarism check.



 
  References Top

1.
Murdoch DR, Howie SR. The global burden of lower respiratory infections: Making progress, but we need to do better. Lancet Infect Dis 2018;18:1162-3.  Back to cited text no. 1
    
2.
Ruiz-González A, Falguera M, Nogués A, Rubio-Caballero M. Is Streptococcus pneumoniae the leading cause of pneumonia of unknown etiology? A microbiologic study of lung aspirates in consecutive patients with community-acquired pneumonia. Am J Med 1999;106:385-90.  Back to cited text no. 2
    
3.
Porath A, Schlaeffer F, Lieberman D. The epidemiology of community-acquired pneumonia among hospitalized adults. J Infect 1997;34:41-8.  Back to cited text no. 3
    
4.
Marrie TJ, Peeling RW, Fine MJ, Singer DE, Coley CM, Kapoor WN. Ambulatory patients with community-acquired pneumonia: The frequency of atypical agents and clinical course. Am J Med 1996;101:508-15.  Back to cited text no. 4
    
5.
Steinhoff D, Lode H, Ruckdeschel G, Heidrich B, Rolfs A, Fehrenbach FJ, et al. Chlamydia pneumoniae as a cause of community-acquired pneumonia in hospitalized patients in Berlin. Clin Infect Dis 1996;22:958-64.  Back to cited text no. 5
    
6.
Bohte R, van Furth R, van den Broek PJ. Aetiology of community-acquired pneumonia: A prospective study among adults requiring admission to hospital. Thora×1995;50:543-7.  Back to cited text no. 6
    
7.
Stolz D, Christ-Crain M, Gencay MM, Bingisser R, Huber PR, Müller B, et al. Diagnostic value of signs, symptoms and laboratory values in lower respiratory tract infection. Swiss Med Wkly 2006;136:434-40.  Back to cited text no. 7
    
8.
Peeling RW, Wang SP, Grayston JT, Blasi F, Boman J, Clad A, et al. Chlamydia pneumoniae serology: Interlaboratory variation in microimmunofluorescence assay results. J Infect Dis 2000;181 Suppl 3:S426-9.  Back to cited text no. 8
    
9.
Petitjean J, Vincent F, Fretigny M, Vabret A, Poveda JD, Brun J, et al. Comparison of two serological methods and a polymerase chain reaction-enzyme immunoassay for the diagnosis of acute respiratory infections with Chlamydia pneumoniae in adults. J Med Microbiol 1998;47:615-21.  Back to cited text no. 9
    
10.
Jain R, Jain A, Agarwal J, Awasthi S. Chlamydia sp. in hospitalised children with community acquired pneumonia. Indian Pediatr 2007;44:216-8.  Back to cited text no. 10
    
11.
Pandey A, Chaudhry R, Kapoor L, Kabra SK. Acute lower respiratory tract infection due to Chlamydia species in children under five years of age. Indian J Chest Dis Allied Sci 2005;47:97-101.  Back to cited text no. 11
    
12.
Boman J, Gaydos CA, Quinn TC. Molecular diagnosis of Chlamydia pneumoniae infection. J Clin Microbiol 1999;37:3791-9.  Back to cited text no. 12
    
13.
Loens K, Ursi D, Goossens H, Ieven M. Molecular diagnosis of Mycoplasma pneumoniae respiratory tract infections. J Clin Microbiol 2003;41:4915-23.  Back to cited text no. 13
    
14.
Daugharty H, Skelton SK, Messmer T. Chlamydia DNA extraction for use in PCR: Stability and sensitivity in detection. J Clin Lab Anal 1998;12:47-53.  Back to cited text no. 14
    
15.
Apfalter P, Barousch W, Nehr M, Makristathis A, Willinger B, Rotter M, et al. Comparison of a new quantitative ompA-based real-Time PCR TaqMan assay for detection of Chlamydia pneumoniae DNA in respiratory specimens with four conventional PCR assays. J Clin Microbiol 2003;41:592-600.  Back to cited text no. 15
    
16.
Wang Sp. The microimmunofluorescence test for Chlamydia pneumoniae infection: Technique and interpretation. J Infect Dis 2000;181 Suppl 3:S421-5.  Back to cited text no. 16
    
17.
Verkooyen RP, Hazenberg MA, van Haaren GH, van Den Bosch JM, Snijder RJ, van Helden HP, et al. Age-related interference with Chlamydia pneumoniae microimmunofluorescence serology due to circulating rheumatoid factor. J Clin Microbiol 1992;30:1287-90.  Back to cited text no. 17
    
18.
Kutlin A, Roblin PM, Hammerschlag MR. Antibody response to Chlamydia pneumoniae infection in children with respiratory illness. J Infect Dis 1998;177:720-4.  Back to cited text no. 18
    
19.
Dowell SF, Peeling RW, Boman J, Carlone GM, Fields BS, Guarner J, et al. Standardizing Chlamydia pneumoniae assays: Recommendations from the centers for disease control and prevention (USA) and the laboratory centre for disease control (Canada). Clin Infect Dis 2001;33:492-503.  Back to cited text no. 19
    



 
 
    Tables

  [Table 1]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Tables

 Article Access Statistics
    Viewed128    
    Printed4    
    Emailed0    
    PDF Downloaded11    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]